Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01915
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01915
Clone name ha04708
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of th ...
Symbol UBN1
cDNA sequence DNA sequence (6423 bp)
Predicted protein sequence (1139 aa)
Flexi ORF Clone FXC01915
Description Ubinuclein (Ubiquitously expressed nuclear protein) (VT4).
Features of the cloned cDNA sequence

Length: 6423 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2224 bp
Genome contig ID gi51511732f_4737458
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TATAAAGCAATTCAATAAATTGTTTCAAGGTTTCC
Flanking genome sequence
(134902 - 134951)
----+----*----+----*----+----*----+----*----+----*
AAAACATTTTTTCTCACTCTTTTCTTTCTACCATGTGGAAGTAAGTAGTT

Features of the protein sequence

Length: 1139 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9NPG3 0 100.0 Ubinuclein-1; U...
Homo sapiens
XP_001169902 0 99.7 ubinuclein 1 is...
Pan troglodytes
AAF31755 0 99.7 ubinuclein [Hom...
Homo sapiens
XP_001169816 0 99.7 ubinuclein 1 is...
Pan troglodytes
XP_001099538 0 97.3 ubinuclein 1 is...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp