Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02012
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02012
Clone name hj03795s2
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CEP162
cDNA sequence DNA sequence (5051 bp)
Predicted protein sequence (1345 aa)
Flexi ORF Clone FXC02012
Description KIAA1009
Features of the cloned cDNA sequence

Length: 5051 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 817 bp
Genome contig ID gi89161210r_84791182
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTGTAAATATTGCTGCAATAAACATACATGTACAG
Flanking genome sequence
(99509 - 99460)
----+----*----+----*----+----*----+----*----+----*
ATATCTTTTTTATATAATGATTTCTGTTCCTTTGGGTAGATTCCCAGTAA

Features of the protein sequence

Length: 1345 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW48644 0 99.7 chromosome 6 op...
Homo sapiens
XP_001086275 0 95.8 similar to zipp...
Macaca mulatta
XP_532220 0 83.9 similar to EEA1...
Canis lupus fam...
AAI51105 0 74.9 RIKEN cDNA 4922...
Mus musculus
XP_001063109 0 74.8 similar to F58G...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp