ORK02034

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02034

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02034
Clone name	fh04333s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	UPF2
cDNA sequence	DNA sequence (5568 bp) Predicted protein sequence (1298 aa)
HaloTag ORF Clone	FHC02034
Flexi ORF Clone	FXC02034
Description	UPF2 regulator of nonsense transcripts homolog (yeast)

Features of the cloned cDNA sequence

Description

Length: 5568 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1275 bp
Genome contig ID	gi89161187r_11902028
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ACCTTTGCCGATGCTGCAATAAAGTGTTGTAATTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGATTTGGCGTGGTGTTGTTTTGTTGGGTTTGGGTTTTGGAAACCGATTG

Features of the protein sequence

Description

Length: 1298 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_507656	99.3	UPF2 regulator ...	Pan troglodytes
Q9HAU5	100.0	Regulator of no...	Homo sapiens
AAG48509	99.9	hUPF2 [Homo sap...	Homo sapiens
XP_857902	97.7	similar to UPF2...	Canis lupus fam...
XP_001249612	97.6	UPF2 regulator ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003890	194	457	PF02854	MIF4G-like
	IPR003890	595	784	PF02854	MIF4G-like
	IPR003890	802	1012	PF02854	MIF4G-like
	IPR007193	1062	1244	PF04050	Up-frameshift suppressor 2
HMMSmart	IPR003890	194	390	SM00543	MIF4G-like
	IPR003890	595	784	SM00543	MIF4G-like
	IPR003890	799	1012	SM00543	MIF4G-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp