Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02062
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB210007
Product ID ORK02062
Clone name fg04974
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol NUMA1
cDNA sequence DNA sequence (7149 bp)
Predicted protein sequence (2121 aa)
Flexi ORF Clone FXC02062
Description Nuclear mitotic apparatus protein 1 (NuMA protein) (SP-H antigen).
Features of the cloned cDNA sequence

Length: 7149 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 662 bp
Genome contig ID gi51511727r_71291559
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TATTACTTGTAAATAAAGTCTATTTTTCTCCCGTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGTACTGAGTTGACTTGATCGGTGTGGGAAAAAGAGGAATATAGGCTCTT

Features of the protein sequence

Length: 2121 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE06089 0 100.0 NUMA1 variant p...
Homo sapiens
Q14980 0 100.0 Nuclear mitotic...
Homo sapiens
CAA77669 0 99.9 NuMA protein [H...
Homo sapiens
EAW74828 0 99.9 nuclear mitotic...
Homo sapiens
2012303A 0 99.8 SP-H antigen.
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp