ORK02066

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02066

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02066
Clone name	hk00185
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NOMO2
cDNA sequence	DNA sequence (4267 bp) Predicted protein sequence (1252 aa)
HaloTag ORF Clone	FHC02066
Flexi ORF Clone	FXC02066
Description	Nodal modulator 2 precursor (pM5 protein 2).

Features of the cloned cDNA sequence

Description

Length: 4267 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	506 bp
Genome contig ID	gi51511732r_18318689
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- AAAAATCAATAAAATGGCCCATTCATTTGTGTTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCTCATCATAGATGTATTTCTTGGATGACATGCACGTAACCCCCGGGAG

Features of the protein sequence

Description

Length: 1252 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH41131	99.9	NODAL modulator...	Homo sapiens
Q5JPE7	99.9	Nodal modulator...	Homo sapiens
AAI56527	99.6	NODAL modulator...	synthetic construct
P69849	99.5	Nodal modulator...	Homo sapiens
NP_055102	99.3	nodal modulator...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008454	174	211	PF05738	Collagen-binding surface protein Cna-like
HMMPfam	IPR008454	905	957	PF05738	Collagen-binding surface protein Cna-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	32	LVGQGAGLLGPAVVTAAVVLLLS	54	PRIMARY	23