ORK02193

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK02193

Order Kazusa clone(s) from :

Accession No
Product ID	ORK02193
Clone name	bm04996
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ENO1
cDNA sequence	DNA sequence (1760 bp) Predicted protein sequence (437 aa)
HaloTag ORF Clone	FHC02193
Flexi ORF Clone	FXC02193
Description	Alpha-enolase (EC 4.2.1.11) (2-phospho-D-glycerate hydro-lyase) (Non- neural enolase) (NNE) (Enolase 1) (Phosphopyruvate hydratase) (C-myc promoter-binding protein) (MBP-1) (MPB-1) (Plasminogen-binding protein).

Features of the cloned cDNA sequence

Description

Length: 1760 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	356 bp
Genome contig ID	gi89161185r_8743650
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TGTGCTCAAAATAAAAAGCCTCAGTGACCCATGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATACTCCGTGTGCCTGTGTATGTCTGGAACAATCTGGGTCTGTCCTTAG

Features of the protein sequence

Description

Length: 437 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P06733	1.6e-176	100.0	Alpha-enolase; ...	Homo sapiens
AAP36132	1.6e-176	100.0	enolase 1, (alp...	synthetic construct
BAE87761	1.9e-176	99.7	unnamed protein...	Macaca fascicularis
BAD96912	2.6e-176	99.7	enolase 1 varia...	Homo sapiens
BAD96237	3.5e-176	99.7	enolase 1 varia...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000941	151	435	PD000902	Enolase
FPrintScan	IPR000941	38	52	PR00148	Enolase
	IPR000941	110	126	PR00148	Enolase
	IPR000941	167	180	PR00148	Enolase
	IPR000941	320	331	PR00148	Enolase
	IPR000941	343	357	PR00148	Enolase
	IPR000941	372	389	PR00148	Enolase
HMMPfam	IPR000941	5	137	PF03952	Enolase
HMMPfam	IPR000941	145	435	PF00113	Enolase
HMMTigr	IPR000941	6	435	TIGR01060	Enolase
ScanRegExp	IPR000941	343	356	PS00164	Enolase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp