Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02591
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02591
Clone name bm03406
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol CREG1
cDNA sequence DNA sequence (1954 bp)
Predicted protein sequence (223 aa)
Flexi ORF Clone FXC02591
Description cellular repressor of E1A-stimulated genes 1
Features of the cloned cDNA sequence

Length: 1954 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1282 bp
Genome contig ID gi89161185r_165676877
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TCAAAGCATCAATAATTAAAAGAATTATTTTAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATGTGTTGGATTCGTTTTCTTAAACATAGACATTAATATTTATTACAC

Features of the protein sequence

Length: 223 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O75629 2.6e-90 100.0 Protein CREG1; ...
Homo sapiens
EAW90794 7.4e-90 99.5 cellular repres...
Homo sapiens
BAG52125 1e-89 99.5 unnamed protein...
Homo sapiens
XP_001157266 2.3e-87 98.1 similar to cell...
Pan troglodytes
XP_001089325 2.6e-87 96.8 similar to cell...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 11 SARALLAALLASTLLALLVSPA 32 PRIMARY 22
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp