Length: 1954 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end
Length of 3'UTR |
1282 bp |
Genome contig ID |
gi89161185r_165676877 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- TCAAAGCATCAATAATTAAAAGAATTATTTTAATG |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAATGTGTTGGATTCGTTTTCTTAAACATAGACATTAATATTTATTACAC |
Length: 223 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
O75629 |
2.6e-90 |
100.0 |
Protein CREG1; ...
|
Homo sapiens
|
EAW90794 |
7.4e-90 |
99.5 |
cellular repres...
|
Homo sapiens
|
BAG52125 |
1e-89 |
99.5 |
unnamed protein...
|
Homo sapiens
|
XP_001157266 |
2.3e-87 |
98.1 |
similar to cell...
|
Pan troglodytes
|
XP_001089325 |
2.6e-87 |
96.8 |
similar to cell...
|
Macaca mulatta
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
11 |
SARALLAALLASTLLALLVSPA |
32 |
PRIMARY |
22 |