Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02633
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02633
Clone name bm05635
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TADA3
cDNA sequence DNA sequence (1920 bp)
Predicted protein sequence (448 aa)
Flexi ORF Clone FXC02633
Description transcriptional adaptor 3 (NGG1 homolog, yeast)-like
Features of the cloned cDNA sequence

Length: 1920 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 383 bp
Genome contig ID gi89161205r_9696658
PolyA signal sequence
(AATAAA,-25)		 
+----*----+----*----+----*----+----
CAAACTTAAGAATAAAGTGACTGCTGTGGTTTTTC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGCATCCAGTCTTTGAATGTCTGTTACAGTGGGGAGGAAGGAAC

Features of the protein sequence

Length: 448 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EDK99455 4.8e-159 97.9 transcriptional...
 Mus musculus
O75528 7.2e-157 100.0 Transcriptional...
 Homo sapiens
XP_001147226 1.1e-156 99.7 transcriptional...
 Pan troglodytes
XP_001494747 1.6e-156 99.7 similar to Tran...
 Equus caballus
BAF84953 1.8e-156 99.7 unnamed protein...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom NULL 17 448 PD684236 NULL
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp