Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02643
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02643
Clone name bm10771
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol KAT5
cDNA sequence DNA sequence (2046 bp)
Predicted protein sequence (475 aa)
Flexi ORF Clone FXC02643
Description K(lysine) acetyltransferase 5
Features of the cloned cDNA sequence

Length: 2046 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 422 bp
Genome contig ID gi51511727f_65136077
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CTATTGCCCCCGGCAATAAATTGTTTCTATATGCC
Flanking genome sequence
(107575 - 107624)
----+----*----+----*----+----*----+----*----+----*
AGAGCCATGCAAAGTTCTTGGTGGGGAGGGGGAAAGGGCCCATGCTGGCT

Features of the protein sequence

Length: 475 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_866353 9.7e-190 97.8 similar to HIV-...
Canis lupus fam...
EDM12512 9.7e-190 97.8 HIV-1 tat inter...
Rattus norvegicus
BAG65439 9.7e-190 98.0 unnamed protein...
Homo sapiens
Q5RBG4 1.2e-189 100.0 Histone acetylt...
Pongo abelii
AAX43690 1.2e-189 100.0 HIV-1 Tat inter...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002717 247 439 PF01853 MOZ/SAS-like protein
HMMSmart IPR000953 39 90 SM00298 Chromo
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp