Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK02975
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK02975
Clone name ee07176
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MLLT3
cDNA sequence DNA sequence (3271 bp)
Predicted protein sequence (575 aa)
Flexi ORF Clone FXC02975
Description Protein AF-9 (ALL1 fused gene from chromosome 9 protein) (Myeloid/lymphoid or mixed-lineage leukemia translocated to chromosome 3 protein) (YEATS domain-containing protein 3).
Features of the cloned cDNA sequence

Length: 3271 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1381 bp
Genome contig ID gi89161216r_20235069
PolyA signal sequence
(AAGAAA,-12)
+----*----+----*----+----*----+----
AAAAGAAAGCAAATTATTTTTAAAAGAAAAAAACC
Flanking genome sequence
(99991 - 99942)
----+----*----+----*----+----*----+----*----+----*
AAAGTACTTTTGGTGTCATTATTCCATCTTCTCCATAAGTGGAGAAATGA

Features of the protein sequence

Length: 575 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH21420 2.1e-159 97.6 Mllt3 protein [...
Mus musculus
XP_001148491 1.4e-113 96.6 myeloid/lymphoi...
Pan troglodytes
CAH70705 1.4e-113 97.0 myeloid/lymphoi...
Homo sapiens
P42568 1.4e-113 96.8 Protein AF-9; A...
Homo sapiens
XP_001108646 1.4e-113 96.6 myeloid/lymphoi...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR005033 53 136 PF03366 YEATS
ProfileScan IPR005033 32 136 PS51037 YEATS
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp