Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04076
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209796
Product ID ORK04076
Clone name bm03230
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol AKR1B1
cDNA sequence DNA sequence (1913 bp)
Predicted protein sequence (260 aa)
Description Aldose reductase (EC 1.1.1.21) (AR) (Aldehyde reductase).
Features of the cloned cDNA sequence

Length: 1913 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1128 bp
Genome contig ID gi89161213r_133677649
PolyA signal sequence
(AATAAA,-19)		 
+----*----+----*----+----*----+----
ACTTCTCTTTGCCTCAAATAAAAAGTGCTTTTGTG
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGCTTGGTTTTGTGAGCTTTGGTTTTTTAAAACAATAGCAACCTTCTATC

Features of the protein sequence

Length: 260 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93033 6.2e-110 100.0 aldo-keto reduc...
 Homo sapiens
1ABN 3.2e-103 96.8 ALDOSE REDUCTASE
 Homo sapiens
1XGD 3.2e-103 96.8 Aldose reductase
 Homo sapiens
1EF3 3.2e-103 96.8 ALDOSE REDUCTASE
 Homo sapiens
P15121 3.2e-103 96.8 Aldose reductas...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001395 3 245 PD000288 Aldo/keto reductase
FPrintScan IPR001395 32 56 PR00069 Aldo/keto reductase
IPR001395 92 110 PR00069 Aldo/keto reductase
IPR001395 142 159 PR00069 Aldo/keto reductase
IPR001395 178 207 PR00069 Aldo/keto reductase
IPR001395 225 249 PR00069 Aldo/keto reductase
HMMPfam IPR001395 4 259 PF00248 Aldo/keto reductase
ScanRegExp IPR001395 36 53 PS00798 Aldo/keto reductase
IPR001395 142 159 PS00062 Aldo/keto reductase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp