Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04234
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208928
Product ID ORK04234
Clone name fj19925
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ATRX
cDNA sequence DNA sequence (4252 bp)
Predicted protein sequence (1384 aa)
Description Transcriptional regulator ATRX (EC 3.6.1.-) (ATP-dependent helicase ATRX) (X-linked helicase II) (X-linked nuclear protein) (XNP) (Znf- HX).
Features of the cloned cDNA sequence

Length: 4252 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi89161218r_76696304
PolyA signal sequence
(AAGAAA,-20)
+----*----+----*----+----*----+----
AGAAAGCAGAGTTGGAAGAAAATCAGCGGAGCTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAACAGAAAAAGAAAAGGCGACGTATTAAGGTTCAAGAAGATTCATCCAG

Features of the protein sequence

Length: 1384 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92165 0 100.0 transcriptional...
Homo sapiens
XP_001099572 0 97.9 similar to tran...
Macaca mulatta
XP_860092 0 86.2 similar to tran...
Canis lupus fam...
BAC81110 0 95.1 ATRX [Homo sapi...
Homo sapiens
EAW98612 0 95.0 alpha thalassem...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp