Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04239
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208876
Product ID ORK04239
Clone name pg00683
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol AXIN1
cDNA sequence DNA sequence (6341 bp)
Predicted protein sequence (514 aa)
Description Axin-1 (Axis inhibition protein 1) (hAxin).
Features of the cloned cDNA sequence

Length: 6341 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4794 bp
Genome contig ID gi51511732r_177441
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
GGATAATAATGAAATAAAACTGTTTTTGAACCTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCTGGCTGTGGTGTGTCTTCTGCGGGTGGGGCCTGGCCTAGGTCTCCCAG

Features of the protein sequence

Length: 514 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92113 6.7e-190 100.0 axin 1 isoform ...
Homo sapiens
XP_001152928 5.7e-187 98.6 axin 1 isoform ...
Pan troglodytes
AAH44648 8.1e-181 98.8 Axin 1 [Homo sa...
Homo sapiens
O15169 8.3e-181 100.0 Axin-1; Axis in...
Homo sapiens
XP_001153054 1.4e-179 97.8 axin 1 isoform ...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR014936 229 261 PF08833 Axin beta-catenin binding
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp