Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04367
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226100
Product ID ORK04367
Clone name fj18843
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol C20orf194
cDNA sequence DNA sequence (4479 bp)
Predicted protein sequence (904 aa)
Description Uncharacterized protein C20orf194.
Features of the cloned cDNA sequence

Length: 4479 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1416 bp
Genome contig ID gi51511747r_3079802
PolyA signal sequence
(AGTAAA,-15)
+----*----+----*----+----*----+----
GCAGCTCTCAAGGGCTTGTCAGTAAAATATATTAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAACAATTTGAAGCCAAATGAACAAAACTCCAGATACCA

Features of the protein sequence

Length: 904 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI22530 0 100.0 C20orf194 prote...
Homo sapiens
Q5TEA3 0 99.8 Uncharacterized...
Homo sapiens
EAX10534 0 99.7 hCG39261, isofo...
Homo sapiens
XP_001111152 0 97.8 hypothetical pr...
Macaca mulatta
CAB53697 0 99.8 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ScanRegExp IPR007087 604 627 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp