Length: 5625 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
732 bp |
| Genome contig ID |
gi51511730f_98930060 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- CAGTCAGTTATCCAAATAAAAGCAGTTCTGAAACT |
Flanking genome sequence (117546 - 117595) |
----+----*----+----*----+----*----+----*----+----* ATCCCTTTCTTTGTTATGGGTGGAAGGTGGGGCTCCAGGCCTTCGCAGTC |
Length: 244 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92610 |
9.4e-62 |
100.0 |
CS0DA006YC23 va...
|
Homo sapiens
|
| CAD62298 |
1.4e-61 |
100.0 |
unnamed protein...
|
Homo sapiens
|
| XP_001107367 |
1.6e-61 |
100.0 |
similar to cycl...
|
Macaca mulatta
|
| EAW81670 |
2.1e-61 |
100.0 |
cyclin K, isofo...
|
Homo sapiens
|
| XP_001925553 |
9.2e-60 |
97.5 |
similar to cycl...
|
Sus scrofa
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.