Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04486
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209373
Product ID ORK04486
Clone name fh17539
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CCNK
cDNA sequence DNA sequence (5625 bp)
Predicted protein sequence (244 aa)
Description Cyclin-K.
Features of the cloned cDNA sequence

Length: 5625 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 732 bp
Genome contig ID gi51511730f_98930060
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CAGTCAGTTATCCAAATAAAAGCAGTTCTGAAACT
Flanking genome sequence
(117546 - 117595)
----+----*----+----*----+----*----+----*----+----*
ATCCCTTTCTTTGTTATGGGTGGAAGGTGGGGCTCCAGGCCTTCGCAGTC

Features of the protein sequence

Length: 244 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92610 9.4e-62 100.0 CS0DA006YC23 va...
Homo sapiens
CAD62298 1.4e-61 100.0 unnamed protein...
Homo sapiens
XP_001107367 1.6e-61 100.0 similar to cycl...
Macaca mulatta
EAW81670 2.1e-61 100.0 cyclin K, isofo...
Homo sapiens
XP_001925553 9.2e-60 97.5 similar to cycl...
Sus scrofa
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp