ORK04500

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04500

Order Kazusa clone(s) from :

Accession No	AB209850
Product ID	ORK04500
Clone name	ef01316
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	CDC16
cDNA sequence	DNA sequence (7728 bp) Predicted protein sequence (221 aa)
Description	Cell division cycle protein 16 homolog (CDC16Hs) (Anaphase-promoting complex subunit 6) (APC6) (Cyclosome subunit 6).

Features of the cloned cDNA sequence

Description

Length: 7728 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3088 bp
Genome contig ID	gi51511729f_113918823
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AGTTATACATAGTGGAATAAAGAAGGTAAACCATC
Flanking genome sequence (137431 - 137480)	----+--------+--------+--------+--------+----* TGTTATGTCTTTTTTTTTCTTTTCCAATAAACTTTTATTTTGGACTAATT

Features of the protein sequence

Description

Length: 221 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93087	4.1e-100	100.0	CDC16 homolog [...	Homo sapiens
EAX09238	3.5e-82	97.8	CDC16 cell divi...	Homo sapiens
BAE91390	3.5e-82	97.8	unnamed protein...	Macaca fascicularis
XP_509754	3.6e-82	97.8	CDC16 homolog i...	Pan troglodytes
XP_001140110	3.6e-82	97.8	CDC16 homolog i...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR013026	50	186	PS50293	Tetratricopeptide region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp