Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04610
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209134
Product ID ORK04610
Clone name fg02615
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol COPS5
cDNA sequence DNA sequence (5691 bp)
Predicted protein sequence (276 aa)
Description COP9 signalosome complex subunit 5 (EC 3.4.-.-) (Signalosome subunit 5) (SGN5) (Jun activation domain-binding protein 1).
Features of the cloned cDNA sequence

Length: 5691 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2726 bp
Genome contig ID gi51511724r_68017871
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AATATTAATATCCTGTAATAAAGCTCTTTAAAATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATTGTCCTTTGATTTTTTTGTGGGAAGATTCGCAATATTTTTCTAGTA

Features of the protein sequence

Length: 276 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92371 6.8e-118 100.0 COP9 signalosom...
Homo sapiens
XP_001494308 7.4e-110 100.0 similar to COP9...
Equus caballus
EAW86930 8.3e-110 100.0 COP9 constituti...
Homo sapiens
XP_522159 1.7e-109 100.0 similar to COP9...
Pan troglodytes
XP_001512862 1.7e-109 100.0 similar to COP9...
Ornithorhynchus...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR003639 26 108 PD363422 Mov34-1
HMMPfam IPR000555 19 133 PF01398 Mov34/MPN/PAD-1
HMMSmart IPR000555 23 160 SM00232 Mov34/MPN/PAD-1
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp