Length: 3441 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
381 bp |
Genome contig ID |
gi51511730f_38715181 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- AGTAACTTTATGCTTAAATAAATTATAGTTGATTT |
Flanking genome sequence (174421 - 174470) |
----+----*----+----*----+----*----+----*----+----* AAAGATTTGTTTGGCATTGATAATAATAAAATCAGTAGTTTTTCTATAAC |
Length: 808 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92765 |
0 |
100.0 |
CTAGE family, m...
|
Homo sapiens
|
O15320 |
7.4e-211 |
99.3 |
Cutaneous T-cel...
|
Homo sapiens
|
EAW65806 |
8.1e-211 |
99.2 |
CTAGE family, m...
|
Homo sapiens
|
NP_005921 |
8.1e-211 |
99.2 |
cutaneous T-cel...
|
Homo sapiens
|
EAW65814 |
1.3e-210 |
99.7 |
CTAGE family, m...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
13 |
KYIFKNLLFFILKVVAALPEGM |
34 |
SECONDARY |
22 |
2 |
44 |
PWELVICAAVVGFFAVLFFLWRS |
66 |
PRIMARY |
23 |