ORK04882

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04882

Order Kazusa clone(s) from :

Accession No	AB208794
Product ID	ORK04882
Clone name	hk09926
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ELL
cDNA sequence	DNA sequence (4006 bp) Predicted protein sequence (565 aa)
Description	RNA polymerase II elongation factor ELL (Eleven-nineteen lysine-rich leukemia protein).

Features of the cloned cDNA sequence

Description

Length: 4006 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2087 bp
Genome contig ID	gi42406306r_18314475
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ACTTTTTTCATTCTCCAATAAATTTCACTGAACTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCTGGCAGCCCAGGCTGCCTGGCTGGTGTGTGTGGTGTGTGGGTGTTG

Features of the protein sequence

Description

Length: 565 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92031	5.9e-190	100.0	elongation fact...	Homo sapiens
EAW84707	1.8e-188	100.0	elongation fact...	Homo sapiens
P55199	3.7e-188	98.9	RNA polymerase ...	Homo sapiens
BAF85794	3.7e-188	98.9	unnamed protein...	Homo sapiens
AAB34056	5.6e-188	98.7	MEN chimeric tr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010844	457	558	PF07303	Occludin and RNA polymerase II elongation factor ELL

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp