Length: 3363 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end
Length of 3'UTR |
2437 bp |
Genome contig ID |
gi89161185r_92650067 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- GGAGGCACAGTTTTGCACAGTATGTTGCATGCGGC |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAATATGAAATAGAGTAGAAGAGATAAAAGTAGTTTTCTGTC |
Length: 307 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92750 |
1.1e-93 |
100.0 |
ecotropic viral...
|
Homo sapiens
|
XP_001153700 |
4.3e-88 |
99.6 |
hypothetical pr...
|
Pan troglodytes
|
XP_537075 |
6.5e-87 |
98.2 |
similar to ecot...
|
Canis lupus fam...
|
XP_422340 |
4e-81 |
91.0 |
hypothetical pr...
|
Gallus gallus
|
BAE22087 |
7.7e-79 |
92.2 |
unnamed protein...
|
Mus musculus
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.