Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04921
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209513
Product ID ORK04921
Clone name fk08875
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol EVI5
cDNA sequence DNA sequence (3363 bp)
Predicted protein sequence (307 aa)
Description Ecotropic viral integration site 5 protein homolog (EVI-5) (Neuroblastoma stage 4S gene).
Features of the cloned cDNA sequence

Length: 3363 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 2437 bp
Genome contig ID gi89161185r_92650067
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GGAGGCACAGTTTTGCACAGTATGTTGCATGCGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAATATGAAATAGAGTAGAAGAGATAAAAGTAGTTTTCTGTC

Features of the protein sequence

Length: 307 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92750 1.1e-93 100.0 ecotropic viral...
Homo sapiens
XP_001153700 4.3e-88 99.6 hypothetical pr...
Pan troglodytes
XP_537075 6.5e-87 98.2 similar to ecot...
Canis lupus fam...
XP_422340 4e-81 91.0 hypothetical pr...
Gallus gallus
BAE22087 7.7e-79 92.2 unnamed protein...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp