Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04930
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208895
Product ID ORK04930
Clone name fk10150
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol EZH2
cDNA sequence DNA sequence (3641 bp)
Predicted protein sequence (376 aa)
Description Enhancer of zeste homolog 2 (ENX-1).
Features of the cloned cDNA sequence

Length: 3641 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 2509 bp
Genome contig ID gi89161213r_148035408
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TTTTCAACTTTGAATAAAGAATACTTGAACTTGTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTTGTTGAATCATCTCTCATAACGTGTCAATAACTGCTTTCAGGACTGCT

Features of the protein sequence

Length: 376 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92132 1.7e-143 100.0 Enhancer of zes...
Homo sapiens
EAW80068 2.3e-127 100.0 enhancer of zes...
Homo sapiens
XP_001166174 1.6e-125 100.0 enhancer of zes...
Pan troglodytes
XP_001166028 1.5e-124 100.0 enhancer of zes...
Pan troglodytes
Q15910 1.5e-124 100.0 Histone-lysine ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMSmart IPR001005 201 292 SM00717 SANT
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp