Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK04933
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208852
Product ID ORK04933
Clone name fj07688
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol F13A1
cDNA sequence DNA sequence (3808 bp)
Predicted protein sequence (757 aa)
Description Coagulation factor XIII A chain precursor (EC 2.3.2.13) (Coagulation factor XIIIa) (Protein-glutamine gamma-glutamyltransferase A chain) (Transglutaminase A chain).
Features of the cloned cDNA sequence

Length: 3808 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1534 bp
Genome contig ID gi89161210r_5989317
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GTAATAGAAGCTTAAAATAAAGTTAAACTGATTAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTGCATCTGTGCAGAAGTGAATGCTTTTAATTTTCAATATAACACACT

Features of the protein sequence

Length: 757 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92089 0 100.0 Coagulation fac...
Homo sapiens
AAA52489 0 99.7 factor XIII pre...
Homo sapiens
XP_518220 0 99.3 coagulation fac...
Pan troglodytes
XP_001096779 0 96.4 coagulation fac...
Macaca mulatta
AAL12161 0 100.0 coagulation fac...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001102 71 192 PF00868 Transglutaminase
IPR002931 335 424 PF01841 Transglutaminase-like
IPR008958 544 648 PF00927 Transglutaminase
IPR008958 656 753 PF00927 Transglutaminase
HMMSmart IPR002931 332 425 SM00460 Transglutaminase-like
ScanRegExp IPR013808 338 355 PS00547 Transglutaminase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp