Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05217
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209689
Product ID ORK05217
Clone name pf06448
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol FNTA
cDNA sequence DNA sequence (7350 bp)
Predicted protein sequence (69 aa)
Description Protein farnesyltransferase/geranylgeranyltransferase type I alpha subunit (EC 2.5.1.58) (EC 2.5.1.59) (CAAX farnesyltransferase alpha subunit) (Ras proteins prenyltransferase alpha) (FTase-alpha) (Type I protein geranyl-geranyltransferase alpha subunit)
Features of the cloned cDNA sequence

Length: 7350 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4812 bp
Genome contig ID gi51511724f_42951183
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
AAGAACGGTTTTGTAATAAAATTATAGCTGTATCT
Flanking genome sequence
(108899 - 108948)
----+----*----+----*----+----*----+----*----+----*
AAAAACAATGCCATAGAAGTTTGATTTTTTAATAGCATTGAACTATATAT

Features of the protein sequence

Length: 69 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92926 9e-29 100.0 farnesyltransfe...
Homo sapiens
AAB61714 2.6e-05 72.2 putative transp...
Homo sapiens
XP_535991 3.9e-05 58.3 similar to tigg...
Canis lupus fam...
XP_875830 0.00021 66.6 similar to puta...
Bos taurus
EAW85970 0.00025 49.0 hCG2041958 [Hom...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp