Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05325
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209385
Product ID ORK05325
Clone name fh19847
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol GOPC
cDNA sequence DNA sequence (5689 bp)
Predicted protein sequence (362 aa)
Description Golgi-associated PDZ and coiled-coil motif-containing protein (PDZ protein interacting specifically with TC10) (PIST) (CFTR-associated ligand) (Fused in glioblastoma).
Features of the cloned cDNA sequence

Length: 5689 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4529 bp
Genome contig ID gi89161210r_117888133
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ATCTCATTTTTTTAAATAAACATTTTGTTTCCTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACGTTAAATATTTTGGCTTGTTATTTATTTCTAGTAGTTCTATTATTTGT

Features of the protein sequence

Length: 362 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92622 5.9e-122 100.0 golgi associate...
Homo sapiens
Q9HD26 2.1e-100 100.0 Golgi-associate...
Homo sapiens
XP_518712 4e-100 99.6 golgi associate...
Pan troglodytes
XP_001109778 7.4e-100 99.3 golgi associate...
Macaca mulatta
Q5RD32 4.4e-99 98.6 Golgi-associate...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp