ORK05374

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05374

Order Kazusa clone(s) from :

Accession No	AB209360
Product ID	ORK05374
Clone name	fh16175
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	GSTZ1
cDNA sequence	DNA sequence (5356 bp) Predicted protein sequence (188 aa)
Description	Maleylacetoacetate isomerase (EC 5.2.1.2) (MAAI) (Glutathione S- transferase zeta 1) (EC 2.5.1.18) (GSTZ1-1).

Features of the cloned cDNA sequence

Description

Length: 5356 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	297 bp
Genome contig ID	gi51511730f_76758818
PolyA signal sequence (ATTAAA,-32)	+--------+--------+----*----+---- CGGATTAAAATGCCTGGCGTGCTCACCGTAACACC
Flanking genome sequence (108772 - 108821)	----+--------+--------+--------+--------+----* ACGGGGAAGGCTGTGTGCCTTTTCTCATCCGCTTTTGTTGTGTGTGACTC

Features of the protein sequence

Description

Length: 188 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92597	2.8e-74	100.0	Glutathione tra...	Homo sapiens
XP_001101890	1e-64	94.3	similar to Male...	Macaca mulatta
BAG37600	1e-54	100.0	unnamed protein...	Homo sapiens
O43708	1.3e-54	100.0	Maleylacetoacet...	Homo sapiens
BAG37978	1.3e-54	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004046	125	169	PF00043	Glutathione S-transferase
HMMTigr	IPR005955	8	183	TIGR01262	Maleylacetoacetate isomerase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp