Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05433
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208812
Product ID ORK05433
Clone name fh17303
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol HLX
cDNA sequence DNA sequence (5607 bp)
Predicted protein sequence (338 aa)
Description Homeobox protein HLX1 (Homeobox protein HB24).
Features of the cloned cDNA sequence

Length: 5607 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4503 bp
Genome contig ID gi89161185f_219019427
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTAAATTTGTAAATAAAATGTTTACTACGGTTTGT
Flanking genome sequence
(105596 - 105645)
----+----*----+----*----+----*----+----*----+----*
AAAGGCCGCTTGGCTTTGCTGGGGGTTGTTAAGGCCAGAGATCTACAACC

Features of the protein sequence

Length: 338 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92049 6.9e-101 100.0 H2.0-like homeo...
Homo sapiens
EAW93288 6.6e-55 92.7 H2.0-like homeo...
Homo sapiens
BAG54598 8.5e-55 92.7 unnamed protein...
Homo sapiens
Q14774 8.5e-55 92.7 H2.0-like homeo...
Homo sapiens
AAC51346 1.2e-54 92.3 similar to HB24...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp