Length: 5607 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
4503 bp |
| Genome contig ID |
gi89161185f_219019427 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- TTAAATTTGTAAATAAAATGTTTACTACGGTTTGT |
Flanking genome sequence (105596 - 105645) |
----+----*----+----*----+----*----+----*----+----* AAAGGCCGCTTGGCTTTGCTGGGGGTTGTTAAGGCCAGAGATCTACAACC |
Length: 338 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92049 |
6.9e-101 |
100.0 |
H2.0-like homeo...
|
Homo sapiens
|
| EAW93288 |
6.6e-55 |
92.7 |
H2.0-like homeo...
|
Homo sapiens
|
| BAG54598 |
8.5e-55 |
92.7 |
unnamed protein...
|
Homo sapiens
|
| Q14774 |
8.5e-55 |
92.7 |
H2.0-like homeo...
|
Homo sapiens
|
| AAC51346 |
1.2e-54 |
92.3 |
similar to HB24...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.