Length: 4260 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
487 bp |
Genome contig ID |
gi51511750r_39536112 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- TGATCCTCAACCAATAAAATCTCAGTTATGAAAAT |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* ATTTTGAAGCACATGGATTAAATTCTGGTTTAAATTTTATTTACAGAATT |
Length: 170 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92482 |
8.1e-77 |
100.0 |
Hypothetical pr...
|
Homo sapiens
|
EAX09655 |
4.4e-73 |
100.0 |
high-mobility g...
|
Homo sapiens
|
EAX09654 |
4.5e-73 |
100.0 |
high-mobility g...
|
Homo sapiens
|
EAX09651 |
4.5e-73 |
100.0 |
high-mobility g...
|
Homo sapiens
|
EAX09656 |
5.1e-73 |
100.0 |
high-mobility g...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
85 |
QRNIFINYFVNASFLVALETFL |
106 |
SECONDARY |
22 |
2 |
120 |
KCFFLRGEIICWLFIFWYNQKIV |
142 |
PRIMARY |
23 |