Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05469
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209851
Product ID ORK05469
Clone name ef01462
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol HSPG2
cDNA sequence DNA sequence (8066 bp)
Predicted protein sequence (2331 aa)
Description Basement membrane-specific heparan sulfate proteoglycan core protein precursor (HSPG) (Perlecan) (PLC).
Features of the cloned cDNA sequence

Length: 8066 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1070 bp
Genome contig ID gi89161185r_21921326
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TCTTGATTTTTCTTAATAAACGGTGCTATCCCCGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CAGGGGCCTCCTGAGTCTTTGATGAGGGCTTCACTCAGTGGAGCCTGTGG

Features of the protein sequence

Length: 2331 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93088 0 100.0 Basement membra...
Homo sapiens
EAW94994 0 99.9 heparan sulfate...
Homo sapiens
EAW94995 0 99.9 heparan sulfate...
Homo sapiens
EAW94997 0 99.9 heparan sulfate...
Homo sapiens
CAC18534 0 99.9 heparan sulfate...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013151 5 59 PF00047 Immunoglobulin
IPR013151 106 160 PF00047 Immunoglobulin
IPR013098 185 265 PF07679 Immunoglobulin I-set
IPR013151 295 349 PF00047 Immunoglobulin
IPR013098 377 460 PF07679 Immunoglobulin I-set
IPR013151 488 542 PF00047 Immunoglobulin
IPR013151 584 638 PF00047 Immunoglobulin
IPR013151 681 735 PF00047 Immunoglobulin
IPR013098 767 850 PF07679 Immunoglobulin I-set
IPR013151 879 933 PF00047 Immunoglobulin
IPR013098 962 1048 PF07679 Immunoglobulin I-set
IPR013098 1052 1142 PF07679 Immunoglobulin I-set
IPR013098 1152 1235 PF07679 Immunoglobulin I-set
IPR013098 1239 1322 PF07679 Immunoglobulin I-set
IPR013151 1354 1408 PF00047 Immunoglobulin
IPR013098 1427 1512 PF07679 Immunoglobulin I-set
IPR013098 1516 1598 PF07679 Immunoglobulin I-set
IPR012680 1632 1768 PF02210 Laminin G
IPR006209 1788 1820 PF00008 EGF-like
IPR006209 1828 1861 PF00008 EGF-like
IPR012680 1897 2025 PF02210 Laminin G
IPR006209 2048 2080 PF00008 EGF-like
IPR006209 2087 2115 PF00008 EGF-like
IPR012680 2174 2304 PF02210 Laminin G
HMMSmart IPR003599 1 75 SM00409 Immunoglobulin subtype
IPR003598 3 64 SM00408 Immunoglobulin subtype 2
IPR003596 7 160 SM00406 Immunoglobulin V-set
IPR003599 98 176 SM00409 Immunoglobulin subtype
IPR003598 104 165 SM00408 Immunoglobulin subtype 2
IPR003599 191 266 SM00409 Immunoglobulin subtype
IPR003598 197 258 SM00408 Immunoglobulin subtype 2
IPR003599 287 365 SM00409 Immunoglobulin subtype
IPR003598 293 354 SM00408 Immunoglobulin subtype 2
IPR003599 383 461 SM00409 Immunoglobulin subtype
IPR003598 389 450 SM00408 Immunoglobulin subtype 2
IPR003599 480 556 SM00409 Immunoglobulin subtype
IPR003598 486 547 SM00408 Immunoglobulin subtype 2
IPR003596 490 542 SM00406 Immunoglobulin V-set
IPR003599 576 654 SM00409 Immunoglobulin subtype
IPR003598 582 643 SM00408 Immunoglobulin subtype 2
IPR003599 673 751 SM00409 Immunoglobulin subtype
IPR003598 679 740 SM00408 Immunoglobulin subtype 2
IPR003596 728 835 SM00406 Immunoglobulin V-set
IPR003599 773 851 SM00409 Immunoglobulin subtype
IPR003598 779 840 SM00408 Immunoglobulin subtype 2
IPR003599 871 950 SM00409 Immunoglobulin subtype
IPR003598 877 938 SM00408 Immunoglobulin subtype 2
IPR003599 968 1049 SM00409 Immunoglobulin subtype
IPR003598 974 1038 SM00408 Immunoglobulin subtype 2
IPR003596 1043 1127 SM00406 Immunoglobulin V-set
IPR003599 1059 1143 SM00409 Immunoglobulin subtype
IPR003598 1065 1132 SM00408 Immunoglobulin subtype 2
IPR003599 1158 1236 SM00409 Immunoglobulin subtype
IPR003598 1164 1225 SM00408 Immunoglobulin subtype 2
IPR003596 1168 1307 SM00406 Immunoglobulin V-set
IPR003599 1245 1323 SM00409 Immunoglobulin subtype
IPR003598 1251 1312 SM00408 Immunoglobulin subtype 2
IPR003599 1346 1424 SM00409 Immunoglobulin subtype
IPR003598 1352 1413 SM00408 Immunoglobulin subtype 2
IPR003599 1435 1513 SM00409 Immunoglobulin subtype
IPR003598 1441 1502 SM00408 Immunoglobulin subtype 2
IPR003599 1521 1599 SM00409 Immunoglobulin subtype
IPR003598 1527 1588 SM00408 Immunoglobulin subtype 2
IPR001791 1624 1768 SM00282 Laminin G
IPR006210 1787 1821 SM00181 EGF
IPR001881 1788 1821 SM00179 EGF-like calcium-binding
IPR006210 1827 1862 SM00181 EGF
IPR001881 1828 1862 SM00179 EGF-like calcium-binding
IPR001791 1889 2025 SM00282 Laminin G
IPR001881 2044 2081 SM00179 EGF-like calcium-binding
IPR006210 2047 2081 SM00181 EGF
IPR001881 2083 2116 SM00179 EGF-like calcium-binding
IPR006210 2086 2116 SM00181 EGF
IPR001791 2166 2304 SM00282 Laminin G
ProfileScan IPR007110 1 73 PS50835 Immunoglobulin-like
IPR007110 82 174 PS50835 Immunoglobulin-like
IPR007110 185 264 PS50835 Immunoglobulin-like
IPR007110 276 363 PS50835 Immunoglobulin-like
IPR007110 377 459 PS50835 Immunoglobulin-like
IPR007110 475 556 PS50835 Immunoglobulin-like
IPR007110 570 652 PS50835 Immunoglobulin-like
IPR007110 663 749 PS50835 Immunoglobulin-like
IPR007110 767 849 PS50835 Immunoglobulin-like
IPR007110 861 946 PS50835 Immunoglobulin-like
IPR007110 962 1047 PS50835 Immunoglobulin-like
IPR007110 1052 1141 PS50835 Immunoglobulin-like
IPR007110 1152 1232 PS50835 Immunoglobulin-like
IPR007110 1239 1323 PS50835 Immunoglobulin-like
IPR007110 1340 1424 PS50835 Immunoglobulin-like
IPR007110 1427 1511 PS50835 Immunoglobulin-like
IPR007110 1516 1597 PS50835 Immunoglobulin-like
IPR001791 1603 1788 PS50025 Laminin G
IPR000742 1786 1821 PS50026 EGF-like
IPR000742 1824 1862 PS50026 EGF-like
IPR001791 1868 2048 PS50025 Laminin G
IPR000742 2044 2081 PS50026 EGF-like
IPR000742 2083 2116 PS50026 EGF-like
IPR001791 2141 2329 PS50025 Laminin G
ScanRegExp IPR013032 1809 1820 PS00022 EGF-like region
IPR013032 1809 1820 PS01186 EGF-like region
IPR013032 1850 1861 PS00022 EGF-like region
IPR013032 2069 2080 PS00022 EGF-like region
IPR013032 2069 2080 PS01186 EGF-like region
IPR013032 2104 2115 PS00022 EGF-like region
IPR013032 2104 2115 PS01186 EGF-like region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp