Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05870
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209498
Product ID ORK05870
Clone name ff07348
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol LRP1
cDNA sequence DNA sequence (10631 bp)
Predicted protein sequence (2359 aa)
Description Low-density lipoprotein receptor-related protein 1 precursor (LRP) (Alpha-2-macroglobulin receptor) (A2MR) (Apolipoprotein E receptor) (APOER) (CD91 antigen).
Features of the cloned cDNA sequence

Length: 10631 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 785 bp
Genome contig ID gi89161190f_55718576
PolyA signal sequence
(AATAAA,-11)		 
+----*----+----*----+----*----+----
CTAAATAACACAGATATTGTTATAAATAAAATTGT
Flanking genome sequence
(174816 - 174865)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAGGCCAAAAAAAAAAAAAAGAAAGAAAAAA

Features of the protein sequence

Length: 2359 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92735 0 100.0 low density lip...
 Homo sapiens
Q07954 0 99.9 Prolow-density ...
 Homo sapiens
NP_002323 0 99.9 prolow-density ...
 Homo sapiens
XP_538245 0 98.2 similar to Low-...
 Canis lupus fam...
Q91ZX7 0 97.6 Prolow-density ...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002172 480 501 PR00261 Low density lipoprotein-receptor
IPR002172 522 543 PR00261 Low density lipoprotein-receptor
IPR002172 560 581 PR00261 Low density lipoprotein-receptor
IPR002172 601 622 PR00261 Low density lipoprotein-receptor
IPR002172 644 665 PR00261 Low density lipoprotein-receptor
IPR002172 731 752 PR00261 Low density lipoprotein-receptor
HMMPfam IPR000033 69 108 PF00058 Low-density lipoprotein receptor
IPR000033 111 158 PF00058 Low-density lipoprotein receptor
IPR000033 160 203 PF00058 Low-density lipoprotein receptor
IPR000033 205 246 PF00058 Low-density lipoprotein receptor
IPR002172 338 377 PF00057 Low density lipoprotein-receptor
IPR002172 380 416 PF00057 Low density lipoprotein-receptor
IPR002172 419 455 PF00057 Low density lipoprotein-receptor
IPR002172 476 504 PF00057 Low density lipoprotein-receptor
IPR002172 510 546 PF00057 Low density lipoprotein-receptor
IPR002172 548 585 PF00057 Low density lipoprotein-receptor
IPR002172 588 628 PF00057 Low density lipoprotein-receptor
IPR002172 632 669 PF00057 Low density lipoprotein-receptor
IPR002172 672 713 PF00057 Low density lipoprotein-receptor
IPR002172 718 755 PF00057 Low density lipoprotein-receptor
IPR006209 760 796 PF00008 EGF-like
IPR013091 798 837 PF07645 EGF calcium-binding
IPR000033 885 928 PF00058 Low-density lipoprotein receptor
IPR000033 930 971 PF00058 Low-density lipoprotein receptor
IPR000033 973 1015 PF00058 Low-density lipoprotein receptor
IPR000033 1017 1058 PF00058 Low-density lipoprotein receptor
IPR000033 1059 1099 PF00058 Low-density lipoprotein receptor
IPR006209 1110 1146 PF00008 EGF-like
IPR002172 1148 1185 PF00057 Low density lipoprotein-receptor
IPR002172 1188 1224 PF00057 Low density lipoprotein-receptor
IPR002172 1227 1264 PF00057 Low density lipoprotein-receptor
IPR002172 1267 1305 PF00057 Low density lipoprotein-receptor
IPR002172 1308 1347 PF00057 Low density lipoprotein-receptor
IPR002172 1350 1386 PF00057 Low density lipoprotein-receptor
IPR002172 1389 1425 PF00057 Low density lipoprotein-receptor
IPR002172 1427 1463 PF00057 Low density lipoprotein-receptor
IPR002172 1468 1506 PF00057 Low density lipoprotein-receptor
IPR002172 1555 1591 PF00057 Low density lipoprotein-receptor
IPR013091 1639 1675 PF07645 EGF calcium-binding
IPR000033 1727 1783 PF00058 Low-density lipoprotein receptor
IPR000033 1785 1826 PF00058 Low-density lipoprotein receptor
IPR000033 1828 1870 PF00058 Low-density lipoprotein receptor
IPR000033 1872 1915 PF00058 Low-density lipoprotein receptor
IPR006209 2015 2046 PF00008 EGF-like
IPR006209 2051 2082 PF00008 EGF-like
IPR006209 2087 2118 PF00008 EGF-like
IPR006209 2192 2223 PF00008 EGF-like
HMMSmart IPR000033 91 133 SM00135 Low-density lipoprotein receptor
IPR000033 139 184 SM00135 Low-density lipoprotein receptor
IPR000033 185 227 SM00135 Low-density lipoprotein receptor
IPR000033 228 269 SM00135 Low-density lipoprotein receptor
IPR006210 297 334 SM00181 EGF
IPR002172 339 379 SM00192 Low density lipoprotein-receptor
IPR002172 381 418 SM00192 Low density lipoprotein-receptor
IPR002172 420 457 SM00192 Low density lipoprotein-receptor
IPR002172 475 506 SM00192 Low density lipoprotein-receptor
IPR002172 511 548 SM00192 Low density lipoprotein-receptor
IPR006210 549 586 SM00181 EGF
IPR002172 549 587 SM00192 Low density lipoprotein-receptor
IPR002172 589 630 SM00192 Low density lipoprotein-receptor
IPR002172 633 671 SM00192 Low density lipoprotein-receptor
IPR006210 633 670 SM00181 EGF
IPR002172 673 715 SM00192 Low density lipoprotein-receptor
IPR002172 719 757 SM00192 Low density lipoprotein-receptor
IPR001881 756 797 SM00179 EGF-like calcium-binding
IPR006210 759 797 SM00181 EGF
IPR001881 798 838 SM00179 EGF-like calcium-binding
IPR006210 801 838 SM00181 EGF
IPR000033 865 909 SM00135 Low-density lipoprotein receptor
IPR000033 910 952 SM00135 Low-density lipoprotein receptor
IPR000033 953 996 SM00135 Low-density lipoprotein receptor
IPR000033 997 1039 SM00135 Low-density lipoprotein receptor
IPR000033 1040 1080 SM00135 Low-density lipoprotein receptor
IPR006210 1109 1147 SM00181 EGF
IPR002172 1149 1187 SM00192 Low density lipoprotein-receptor
IPR002172 1189 1226 SM00192 Low density lipoprotein-receptor
IPR002172 1228 1266 SM00192 Low density lipoprotein-receptor
IPR002172 1268 1307 SM00192 Low density lipoprotein-receptor
IPR002172 1309 1349 SM00192 Low density lipoprotein-receptor
IPR002172 1351 1388 SM00192 Low density lipoprotein-receptor
IPR002172 1390 1427 SM00192 Low density lipoprotein-receptor
IPR006210 1390 1426 SM00181 EGF
IPR002172 1428 1465 SM00192 Low density lipoprotein-receptor
IPR002172 1469 1508 SM00192 Low density lipoprotein-receptor
IPR002172 1510 1549 SM00192 Low density lipoprotein-receptor
IPR002172 1556 1593 SM00192 Low density lipoprotein-receptor
IPR006210 1556 1592 SM00181 EGF
IPR001881 1587 1638 SM00179 EGF-like calcium-binding
IPR006210 1599 1638 SM00181 EGF
IPR001881 1639 1676 SM00179 EGF-like calcium-binding
IPR006210 1642 1676 SM00181 EGF
IPR000033 1707 1749 SM00135 Low-density lipoprotein receptor
IPR000033 1765 1807 SM00135 Low-density lipoprotein receptor
IPR000033 1808 1851 SM00135 Low-density lipoprotein receptor
IPR000033 1852 1894 SM00135 Low-density lipoprotein receptor
IPR006210 1965 1998 SM00181 EGF
IPR006210 2014 2047 SM00181 EGF
IPR001881 2047 2083 SM00179 EGF-like calcium-binding
IPR006210 2050 2083 SM00181 EGF
IPR006210 2086 2119 SM00181 EGF
IPR006210 2122 2155 SM00181 EGF
IPR006210 2158 2190 SM00181 EGF
IPR006210 2191 2224 SM00181 EGF
ProfileScan IPR000033 69 110 PS51120 Low-density lipoprotein receptor
IPR000033 111 159 PS51120 Low-density lipoprotein receptor
IPR000033 160 204 PS51120 Low-density lipoprotein receptor
IPR000033 205 247 PS51120 Low-density lipoprotein receptor
IPR000033 248 289 PS51120 Low-density lipoprotein receptor
IPR002172 339 378 PS50068 Low density lipoprotein-receptor
IPR002172 381 417 PS50068 Low density lipoprotein-receptor
IPR002172 420 456 PS50068 Low density lipoprotein-receptor
IPR002172 454 505 PS50068 Low density lipoprotein-receptor
IPR002172 511 547 PS50068 Low density lipoprotein-receptor
IPR002172 549 586 PS50068 Low density lipoprotein-receptor
IPR002172 589 629 PS50068 Low density lipoprotein-receptor
IPR002172 633 670 PS50068 Low density lipoprotein-receptor
IPR002172 673 714 PS50068 Low density lipoprotein-receptor
IPR002172 719 756 PS50068 Low density lipoprotein-receptor
IPR000742 798 833 PS50026 EGF-like
IPR000033 885 929 PS51120 Low-density lipoprotein receptor
IPR000033 930 972 PS51120 Low-density lipoprotein receptor
IPR000033 973 1016 PS51120 Low-density lipoprotein receptor
IPR000033 1017 1059 PS51120 Low-density lipoprotein receptor
IPR000033 1060 1100 PS51120 Low-density lipoprotein receptor
IPR002172 1149 1186 PS50068 Low density lipoprotein-receptor
IPR002172 1189 1225 PS50068 Low density lipoprotein-receptor
IPR002172 1228 1265 PS50068 Low density lipoprotein-receptor
IPR002172 1268 1306 PS50068 Low density lipoprotein-receptor
IPR002172 1309 1348 PS50068 Low density lipoprotein-receptor
IPR002172 1351 1387 PS50068 Low density lipoprotein-receptor
IPR002172 1390 1426 PS50068 Low density lipoprotein-receptor
IPR002172 1428 1464 PS50068 Low density lipoprotein-receptor
IPR002172 1469 1507 PS50068 Low density lipoprotein-receptor
IPR002172 1510 1548 PS50068 Low density lipoprotein-receptor
IPR002172 1556 1592 PS50068 Low density lipoprotein-receptor
IPR000033 1727 1739 PS51120 Low-density lipoprotein receptor
IPR000033 1785 1827 PS51120 Low-density lipoprotein receptor
IPR000033 1828 1871 PS51120 Low-density lipoprotein receptor
IPR000033 1872 1916 PS51120 Low-density lipoprotein receptor
IPR000742 2011 2044 PS50026 EGF-like
IPR000742 2047 2083 PS50026 EGF-like
IPR000742 2084 2116 PS50026 EGF-like
IPR000742 2119 2155 PS50026 EGF-like
IPR000742 2190 2224 PS50026 EGF-like
ScanRegExp IPR002172 353 377 PS01209 Low density lipoprotein-receptor
IPR002172 394 416 PS01209 Low density lipoprotein-receptor
IPR002172 433 455 PS01209 Low density lipoprotein-receptor
IPR002172 524 546 PS01209 Low density lipoprotein-receptor
IPR002172 562 585 PS01209 Low density lipoprotein-receptor
IPR002172 603 628 PS01209 Low density lipoprotein-receptor
IPR002172 646 669 PS01209 Low density lipoprotein-receptor
IPR002172 733 755 PS01209 Low density lipoprotein-receptor
IPR000152 772 783 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 781 796 PS01186 EGF-like region
IPR001881 798 821 PS01187 EGF-like calcium-binding
IPR000152 812 823 PS00010 Aspartic acid and asparagine hydroxylation site
IPR002172 1162 1185 PS01209 Low density lipoprotein-receptor
IPR002172 1242 1264 PS01209 Low density lipoprotein-receptor
IPR002172 1282 1305 PS01209 Low density lipoprotein-receptor
IPR002172 1323 1347 PS01209 Low density lipoprotein-receptor
IPR002172 1364 1386 PS01209 Low density lipoprotein-receptor
IPR002172 1403 1425 PS01209 Low density lipoprotein-receptor
IPR002172 1441 1463 PS01209 Low density lipoprotein-receptor
IPR002172 1525 1547 PS01209 Low density lipoprotein-receptor
IPR013032 1622 1637 PS01186 EGF-like region
IPR013032 2035 2046 PS00022 EGF-like region
IPR013032 2071 2082 PS00022 EGF-like region
IPR013032 2071 2082 PS01186 EGF-like region
IPR013032 2107 2118 PS00022 EGF-like region
IPR013032 2107 2118 PS01186 EGF-like region
IPR013032 2143 2154 PS00022 EGF-like region
IPR013032 2212 2223 PS00022 EGF-like region

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 2237 ASILIPLLLLLLLVLVAGVVFWY 2259 PRIMARY 23
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp