ORK05894

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05894

Order Kazusa clone(s) from :

Accession No	AB209740
Product ID	ORK05894
Clone name	eh00603
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	LTA4H
cDNA sequence	DNA sequence (6109 bp) Predicted protein sequence (219 aa)
Description	Leukotriene A-4 hydrolase (EC 3.3.2.6) (LTA-4 hydrolase) (Leukotriene A(4) hydrolase).

Features of the cloned cDNA sequence

Description

Length: 6109 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	5449 bp
Genome contig ID	gi89161190r_94818810
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- GTGATTTTACTGAAATAAAGTTGAGCTACTTCTTC
Flanking genome sequence (99932 - 99883)	----+--------+--------+--------+--------+----* TTATAGTGGCATATTCTTTGTAAATTTTAACAAGGTTTAATCTTTTGATT

Features of the protein sequence

Description

Length: 219 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92977	2.7e-90	100.0	leukotriene A4 ...	Homo sapiens
EAW97560	2.2e-87	99.0	leukotriene A4 ...	Homo sapiens
XP_001145832	2.3e-87	99.0	leukotriene A4 ...	Pan troglodytes
EAW97558	2.4e-87	99.0	leukotriene A4 ...	Homo sapiens
XP_509283	2.5e-87	99.0	leukotriene A4 ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR014782	145	160	PR00756	Peptidase M1
FPrintScan	IPR014782	195	210	PR00756	Peptidase M1
HMMPfam	IPR014782	16	219	PF01433	Peptidase M1

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	198	KVPIPCYLIALVVGALESRVVM	219	PRIMARY	22