Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05912
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209141
Product ID ORK05912
Clone name fg05024
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MAN2C1
cDNA sequence DNA sequence (5698 bp)
Predicted protein sequence (259 aa)
Description Alpha-mannosidase 2C1 (EC 3.2.1.24) (Alpha-D-mannoside mannohydrolase) (Mannosidase alpha class 2C member 1) (Alpha mannosidase 6A8B).
Features of the cloned cDNA sequence

Length: 5698 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4918 bp
Genome contig ID gi51511731r_73337510
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGCGACAGAGCGAGACTCTGTCTC
Flanking genome sequence
(99522 - 99473)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAATACAAAAATTGGCCAGGCGCAGTGTTCTCA

Features of the protein sequence

Length: 259 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92378 4.3e-117 100.0 mannosidase, al...
Homo sapiens
AAH80191 5.2e-105 99.5 MAN2C1 protein ...
Homo sapiens
Q9NTJ4 5.3e-105 99.5 Alpha-mannosida...
Homo sapiens
EAW99252 5.3e-105 99.5 mannosidase, al...
Homo sapiens
EAW99253 5.4e-105 99.5 mannosidase, al...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp