Length: 5698 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
4918 bp |
Genome contig ID |
gi51511731r_73337510 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- ACTCCAGCCTGGGCGACAGAGCGAGACTCTGTCTC |
Flanking genome sequence (99522 - 99473) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAAAAAAAAAAAAATACAAAAATTGGCCAGGCGCAGTGTTCTCA |
Length: 259 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92378 |
4.3e-117 |
100.0 |
mannosidase, al...
|
Homo sapiens
|
AAH80191 |
5.2e-105 |
99.5 |
MAN2C1 protein ...
|
Homo sapiens
|
Q9NTJ4 |
5.3e-105 |
99.5 |
Alpha-mannosida...
|
Homo sapiens
|
EAW99252 |
5.3e-105 |
99.5 |
mannosidase, al...
|
Homo sapiens
|
EAW99253 |
5.4e-105 |
99.5 |
mannosidase, al...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.