Length: 7429 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
554 bp |
Genome contig ID |
gi89161207r_103671708 |
PolyA signal sequence (AATAAA,-19) |
+----*----+----*----+----*----+---- TGTGAAATTATATAAAAATAAAAGTTATATAAATT |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* ACATTGACAACTTGATATTTCATCTGTGGCTTATTTAACCGTTCTATAAA |
Length: 457 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD93083 |
2e-209 |
100.0 |
mannosidase, be...
|
Homo sapiens
|
AAH15743 |
3.5e-202 |
99.7 |
Mannosidase, be...
|
Homo sapiens
|
AAC39573 |
1.3e-201 |
99.5 |
beta-mannosidas...
|
Homo sapiens
|
O00462 |
1.3e-201 |
99.5 |
Beta-mannosidas...
|
Homo sapiens
|
BAF84287 |
2e-201 |
99.3 |
unnamed protein...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
1 |
IFYVNSLKIILCFLNFQI |
18 |
PRIMARY |
18 |