ORK05913

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05913

Order Kazusa clone(s) from :

Accession No	AB209846
Product ID	ORK05913
Clone name	ef01057
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	MANBA
cDNA sequence	DNA sequence (7429 bp) Predicted protein sequence (457 aa)
Description	Beta-mannosidase precursor (EC 3.2.1.25) (Lysosomal beta A mannosidase) (Mannanase) (Mannase).

Features of the cloned cDNA sequence

Description

Length: 7429 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	554 bp
Genome contig ID	gi89161207r_103671708
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGTGAAATTATATAAAAATAAAAGTTATATAAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATTGACAACTTGATATTTCATCTGTGGCTTATTTAACCGTTCTATAAA

Features of the protein sequence

Description

Length: 457 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93083	2e-209	100.0	mannosidase, be...	Homo sapiens
AAH15743	3.5e-202	99.7	Mannosidase, be...	Homo sapiens
AAC39573	1.3e-201	99.5	beta-mannosidas...	Homo sapiens
O00462	1.3e-201	99.5	Beta-mannosidas...	Homo sapiens
BAF84287	2e-201	99.3	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	IFYVNSLKIILCFLNFQI	18	PRIMARY	18