Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05946
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209469
Product ID ORK05946
Clone name ah04804
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MCEE
cDNA sequence DNA sequence (5909 bp)
Predicted protein sequence (67 aa)
Description Methylmalonyl-CoA epimerase, mitochondrial precursor (EC 5.1.99.1) (DL-methylmalonyl-CoA racemase).
Features of the cloned cDNA sequence

Length: 5909 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 282 bp
Genome contig ID gi89161199r_71090326
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
ATTAAAATCATATAGAAATAAATTATTCCTCTTCT
Flanking genome sequence
(205905 - 205856)
----+----*----+----*----+----*----+----*----+----*
TGAAGGAATAACTAGTATTACAAACAGTGGGTTAGGCAGATTCCTTACTT

Features of the protein sequence

Length: 67 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92706 8.9e-26 100.0 methylmalonyl-C...
Homo sapiens
XP_001147220 4.3e-17 98.0 similar to meth...
Pan troglodytes
AAH20825 4.8e-17 96.1 Methylmalonyl C...
Homo sapiens
XP_515538 4.8e-17 96.1 methylmalonyl-C...
Pan troglodytes
Q96PE7 4.8e-17 96.1 Methylmalonyl-C...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp