Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05995
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209819
Product ID ORK05995
Clone name bm04574
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MINPP1
cDNA sequence DNA sequence (2283 bp)
Predicted protein sequence (288 aa)
Description Multiple inositol polyphosphate phosphatase 1 precursor (EC 3.1.3.62) (Inositol (1,3,4,5)-tetrakisphosphate 3-phosphatase) (Ins(1,3,4,5)P(4) 3-phosphatase).
Features of the cloned cDNA sequence

Length: 2283 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1415 bp
Genome contig ID gi89161187f_89154640
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TGAAAGTATTTGCTATAATAAAGAAAATTCTTCTG
Flanking genome sequence
(148481 - 148530)
----+----*----+----*----+----*----+----*----+----*
ACTTTACTACCAGGACTTTTCTCTTCCCCATGTCAAAATACAATCAATAA

Features of the protein sequence

Length: 288 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93056 1.1e-122 100.0 Multiple inosit...
Homo sapiens
AAD09752 2.7e-119 98.9 multiple inosit...
Homo sapiens
Q9UNW1 2.9e-118 99.2 Multiple inosit...
Homo sapiens
XP_507896 5.2e-118 97.5 multiple inosit...
Pan troglodytes
CAB43673 6.2e-118 98.9 hypothetical pr...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000560 83 202 PF00328 Histidine acid phosphatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp