Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06038
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209905
Product ID ORK06038
Clone name eh00728
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MRPS15
cDNA sequence DNA sequence (5104 bp)
Predicted protein sequence (164 aa)
Description 28S ribosomal protein S15, mitochondrial precursor (S15mt) (MRP-S15).
Features of the cloned cDNA sequence

Length: 5104 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4609 bp
Genome contig ID gi89161185r_36593963
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GACACTCAAAGACAGCCAATAAATTCTGTTCAATC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTCTTTCTGTCTTGAAGAATGATAGGAGAGATGATGGGGCTCTTTTTG

Features of the protein sequence

Length: 164 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93142 1.1e-65 100.0 mitochondrial r...
Homo sapiens
P82914 1.9e-48 100.0 28S ribosomal p...
Homo sapiens
XP_524665 1.2e-47 97.6 mitochondrial r...
Pan troglodytes
BAE90735 1e-41 85.2 unnamed protein...
Macaca fascicularis
XP_001111055 9.3e-34 78.1 mitochondrial r...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp