Length: 5104 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
4609 bp |
Genome contig ID |
gi89161185r_36593963 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- GACACTCAAAGACAGCCAATAAATTCTGTTCAATC |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* ATTTCTTTCTGTCTTGAAGAATGATAGGAGAGATGATGGGGCTCTTTTTG |
Length: 164 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD93142 |
1.1e-65 |
100.0 |
mitochondrial r...
|
Homo sapiens
|
P82914 |
1.9e-48 |
100.0 |
28S ribosomal p...
|
Homo sapiens
|
XP_524665 |
1.2e-47 |
97.6 |
mitochondrial r...
|
Pan troglodytes
|
BAE90735 |
1e-41 |
85.2 |
unnamed protein...
|
Macaca fascicularis
|
XP_001111055 |
9.3e-34 |
78.1 |
mitochondrial r...
|
Macaca mulatta
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.