Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06083
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209423
Product ID ORK06083
Clone name pg00753
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MYO15A
cDNA sequence DNA sequence (6540 bp)
Predicted protein sequence (1103 aa)
Description Myosin-XV (Unconventional myosin-15).
Features of the cloned cDNA sequence

Length: 6540 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3226 bp
Genome contig ID gi51511734f_17863207
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAGCCTGGGTGACAGACAGAGCGAGACTCCATCTC
Flanking genome sequence
(106542 - 106591)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAAAGAATGGTGGATGCCAGAGGCAGA

Features of the protein sequence

Length: 1103 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92660 0 100.0 myosin XV varia...
Homo sapiens
EAW55665 0 99.8 myosin XVA, iso...
Homo sapiens
NP_057323 0 99.8 myosin XV [Homo...
Homo sapiens
EAW55663 0 99.8 myosin XVA, iso...
Homo sapiens
EAW55666 0 99.8 myosin XVA, iso...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp