Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06273
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209742
Product ID ORK06273
Clone name eh00785
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PARP9
cDNA sequence DNA sequence (5424 bp)
Predicted protein sequence (359 aa)
Description Poly [ADP-ribose] polymerase 9 (EC 2.4.2.30) (PARP-9) (B aggressive lymphoma protein).
Features of the cloned cDNA sequence

Length: 5424 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4342 bp
Genome contig ID gi89161205r_123633693
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GTAAACAAAATAAAATAATAAAAAAAAAACAACCC
Flanking genome sequence
(99617 - 99568)
----+----*----+----*----+----*----+----*----+----*
ATGCTCTGAATCCTTCTGGTTTTTAGCTTTTGGTTCAAAAAGCCCTTTTC

Features of the protein sequence

Length: 359 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92979 5.9e-147 100.0 B aggressive ly...
Homo sapiens
XP_001167207 2.2e-143 98.0 poly (ADP-ribos...
Pan troglodytes
AAK07559 9.3e-139 100.0 B aggressive ly...
Homo sapiens
BAG36276 9.6e-139 100.0 unnamed protein...
Homo sapiens
AAK07558 9.6e-139 100.0 B aggressive ly...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002589 2 60 PF01661 Appr-1-p processing
ProfileScan IPR002589 1 101 PS51154 Appr-1-p processing
IPR012317 242 359 PS51059 PARP
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp