Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06494
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209027
Product ID ORK06494
Clone name hh00472
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PRMT8
cDNA sequence DNA sequence (5900 bp)
Predicted protein sequence (269 aa)
Description Protein arginine N-methyltransferase 8 (EC 2.1.1.-) (Heterogeneous nuclear ribonucleoprotein methyltransferase-like protein 4).
Features of the cloned cDNA sequence

Length: 5900 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 788 bp
Genome contig ID gi89161190f_3370740
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GACTCCGTGGGCGCTCAATAAACACACATGAGAAC
Flanking genome sequence
(202659 - 202708)
----+----*----+----*----+----*----+----*----+----*
AAACTGGTGGGATGGCTGGTTCCTGGTGCTGTGAAGTGGGAGGGCTGGGG

Features of the protein sequence

Length: 269 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92264 5.7e-125 100.0 Protein arginin...
Homo sapiens
AAF91390 2.5e-117 99.6 arginine N-meth...
Homo sapiens
XP_001155953 2.8e-117 99.6 HMT1 hnRNP meth...
Pan troglodytes
XP_508936 2.8e-117 99.6 HMT1 hnRNP meth...
Pan troglodytes
XP_001156280 2.9e-117 99.6 HMT1 hnRNP meth...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp