Length: 6069 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR |
197 bp |
Genome contig ID |
gi89161210r_139167697 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- TTAATTTCGACAATAAAAAGGTCAGGATGGCGTTT |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* TCTGGAGGGTAGATTGTGTTTGTTGGCACACCCACCTTTTCTGTTCCCTA |
Length: 293 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92380 |
1.4e-81 |
100.0 |
RalBP1 associat...
|
Homo sapiens
|
EAW47905 |
1.2e-79 |
99.6 |
RALBP1 associat...
|
Homo sapiens
|
CAD38569 |
1.2e-79 |
100.0 |
hypothetical pr...
|
Homo sapiens
|
Q96D71 |
1.8e-79 |
99.6 |
RalBP1-associat...
|
Homo sapiens
|
NP_001122089 |
1.9e-79 |
99.6 |
ralBP1-associat...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.