Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06628
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209143
Product ID ORK06628
Clone name fg05769
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol REPS1
cDNA sequence DNA sequence (6069 bp)
Predicted protein sequence (293 aa)
Description RalBP1-associated Eps domain-containing protein 1 (RalBP1-interacting protein 1).
Features of the cloned cDNA sequence

Length: 6069 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 197 bp
Genome contig ID gi89161210r_139167697
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTAATTTCGACAATAAAAAGGTCAGGATGGCGTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TCTGGAGGGTAGATTGTGTTTGTTGGCACACCCACCTTTTCTGTTCCCTA

Features of the protein sequence

Length: 293 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92380 1.4e-81 100.0 RalBP1 associat...
Homo sapiens
EAW47905 1.2e-79 99.6 RALBP1 associat...
Homo sapiens
CAD38569 1.2e-79 100.0 hypothetical pr...
Homo sapiens
Q96D71 1.8e-79 99.6 RalBP1-associat...
Homo sapiens
NP_001122089 1.9e-79 99.6 ralBP1-associat...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp