Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06808
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209900
Product ID ORK06808
Clone name eh00588
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol SGSH
cDNA sequence DNA sequence (5561 bp)
Predicted protein sequence (276 aa)
Description N-sulphoglucosamine sulphohydrolase precursor (EC 3.10.1.1) (Sulfoglucosamine sulfamidase) (Sulphamidase).
Features of the cloned cDNA sequence

Length: 5561 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 4730 bp
Genome contig ID gi51511734r_75697676
PolyA signal sequence
(AGTAAA,-28)
+----*----+----*----+----*----+----
TTATTTTAGTAAAATATACAGAAGTTCTTTTTCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTCATTTATGATGATACCAACCTGAATTCTAGAACAGCTTCCTGATTC

Features of the protein sequence

Length: 276 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93137 2.4e-124 100.0 N-sulfoglucosam...
Homo sapiens
P51688 1.1e-98 96.1 N-sulphoglucosa...
Homo sapiens
BAD96610 1.1e-98 96.1 N-sulfoglucosam...
Homo sapiens
EAW89591 1.1e-98 96.1 N-sulfoglucosam...
Homo sapiens
XP_001110101 5.5e-95 97.2 N-sulfoglucosam...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000917 24 214 PF00884 Sulphatase
ScanRegExp IPR000917 71 83 PS00523 Sulphatase
IPR000917 118 128 PS00149 Sulphatase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp