Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07078
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209741
Product ID ORK07078
Clone name eh00733
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol TCF4
cDNA sequence DNA sequence (5352 bp)
Predicted protein sequence (435 aa)
Description Transcription factor 4 (Immunoglobulin transcription factor 2) (ITF-2) (SL3-3 enhancer factor 2) (SEF-2).
Features of the cloned cDNA sequence

Length: 5352 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3979 bp
Genome contig ID gi51511735r_50946078
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTCAGCATTCCCAATTATCAAAAAACAGAAAAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAGAAAGAAAAAAGTGCAACTTGAGGGACGACTTTCTTTAACAT

Features of the protein sequence

Length: 435 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92978 2.2e-146 100.0 transcription f...
Homo sapiens
AAI25085 2e-143 99.7 TCF4 protein [H...
Homo sapiens
EAW63021 2.3e-143 99.7 transcription f...
Homo sapiens
XP_001084466 2.4e-143 99.7 transcription f...
Macaca mulatta
BAG52974 7.8e-143 100.0 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp