Length: 5352 bp
Physical map
Restriction map

Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end
| Length of 3'UTR |
3979 bp |
| Genome contig ID |
gi51511735r_50946078 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- TTTCAGCATTCCCAATTATCAAAAAACAGAAAAAC |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AAAAAAAAGAAAGAAAAAAGTGCAACTTGAGGGACGACTTTCTTTAACAT |
Length: 435 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
| Entry |
Exp |
ID% |
Protein |
Source |
| BAD92978 |
2.2e-146 |
100.0 |
transcription f...
|
Homo sapiens
|
| AAI25085 |
2e-143 |
99.7 |
TCF4 protein [H...
|
Homo sapiens
|
| EAW63021 |
2.3e-143 |
99.7 |
transcription f...
|
Homo sapiens
|
| XP_001084466 |
2.4e-143 |
99.7 |
transcription f...
|
Macaca mulatta
|
| BAG52974 |
7.8e-143 |
100.0 |
unnamed protein...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.