ORK07277

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07277

Order Kazusa clone(s) from :

Accession No	AK226077
Product ID	ORK07277
Clone name	sh02214
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	UCP2
cDNA sequence	DNA sequence (5616 bp) Predicted protein sequence (143 aa)
Description	Mitochondrial uncoupling protein 2 (UCP 2) (UCPH).

Length: 5616 bp

Physical map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5183 bp
Genome contig ID	gi51511727f_2339695
PolyA signal sequence (CATAAA,-22)	+--------+--------+----*----+---- CCCACTTGTCATCCATAAAGCAAGCTCAACCTTGG
Flanking genome sequence	None

Features of the protein sequence

Length: 143 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

No significant homologues

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	91	SQGGAFWWFGFWIGGCWVGLHGC	113	PRIMARY	23