Length: 5616 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
5183 bp |
Genome contig ID |
gi51511727f_2339695 |
PolyA signal sequence (CATAAA,-22) |
+----*----+----*----+----*----+---- CCCACTTGTCATCCATAAAGCAAGCTCAACCTTGG |
Flanking genome sequence |
None |
Length: 143 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
No significant homologues
Prediction of transmembrane (TM) segments
Method |
No. |
N terminal |
transmembrane region |
C terminal |
type |
length |
SOSUI2 |
1 |
91 |
SQGGAFWWFGFWIGGCWVGLHGC |
113 |
PRIMARY |
23 |