Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07437
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209621
Product ID ORK07437
Clone name sh01289
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZMYND10
cDNA sequence DNA sequence (5447 bp)
Predicted protein sequence (254 aa)
Description Zinc finger MYND domain-containing protein 10 (BLu protein).
Features of the cloned cDNA sequence

Length: 5447 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 611 bp
Genome contig ID gi89161205r_50253515
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAACACGGGTATCTCCGCGTGGTGCTTTGCGGTCG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCGTCGTTGTGGCCGTCCGGGGTGGGGTGTGAGGAGGGGACGAAGGAGGG

Features of the protein sequence

Length: 254 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92858 5.9e-96 100.0 zinc finger, MY...
Homo sapiens
AAB67311 6.8e-08 95.5 match to W07770...
Homo sapiens
XP_001168867 7.4e-08 47.6 zinc finger, MY...
Pan troglodytes
XP_001168913 7.5e-08 47.6 zinc finger, MY...
Pan troglodytes
AAC24728 8.6e-08 47.6 BLu protein tes...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp