Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07575
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209135
Product ID ORK07575
Clone name fg03250
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MAML1
cDNA sequence DNA sequence (6941 bp)
Predicted protein sequence (761 aa)
Description Homo sapiens mRNA for mastermind-like 1 variant protein.
Features of the cloned cDNA sequence

Length: 6941 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4641 bp
Genome contig ID gi51511721f_178992458
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TCCTAGTCTCTATCATTAAAGTTCTAGTGACCGAG
Flanking genome sequence
(163662 - 163711)
----+----*----+----*----+----*----+----*----+----*
ACCCGGGCTGCGTTCTCTGGGTCCGCGGGGGTGGCGCACCGCGGGCTACG

Features of the protein sequence

Length: 761 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92372 0 100.0 mastermind-like...
Homo sapiens
Q92585 8.7e-174 97.3 Mastermind-like...
Homo sapiens
XP_527150 1.6e-170 96.3 mastermind-like...
Pan troglodytes
XP_001105097 3.4e-168 94.4 mastermind-like...
Macaca mulatta
AAF34658 7.5e-161 98.4 Mam1 [Homo sapi...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp