Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07581
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209351
Product ID ORK07581
Clone name fh14292
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol AMDHD2
cDNA sequence DNA sequence (5160 bp)
Predicted protein sequence (192 aa)
Description amidohydrolase domain containing 2
Features of the cloned cDNA sequence

Length: 5160 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 578 bp
Genome contig ID gi51511732f_2413144
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TCGGGAGCCCTGCTGGATTGATGCCCAGGGCCTGT
Flanking genome sequence
(106543 - 106592)
----+----*----+----*----+----*----+----*----+----*
GCGGCCGCCCTGGAGGCGGTGGCTGGGATAAACGTGCACCCAGCAGGACT

Features of the protein sequence

Length: 192 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92588 5.9e-75 100.0 CGI-14 protein ...
Homo sapiens
XP_510749 3.1e-64 100.0 amidohydrolase ...
Pan troglodytes
XP_001163434 4e-64 95.5 similar to amid...
Pan troglodytes
XP_001163691 9.3e-64 100.0 amidohydrolase ...
Pan troglodytes
AAH18734 9.3e-64 100.0 Amidohydrolase ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp