Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07597
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209230
Product ID ORK07597
Clone name fj13957
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol DMTF1
cDNA sequence DNA sequence (3851 bp)
Predicted protein sequence (377 aa)
Description cyclin D binding myb-like transcription factor 1
Features of the cloned cDNA sequence

Length: 3851 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1183 bp
Genome contig ID gi89161213f_86519695
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
ATTCAGTTTAACAGAAATAAAAGAATATTTGTCTT
Flanking genome sequence
(143882 - 143931)
----+----*----+----*----+----*----+----*----+----*
AAGATGCAAGATTTGTTTTTACATAGCCTTTTGCCATACAATTATAAAAA

Features of the protein sequence

Length: 377 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92467 6e-139 100.0 Cyclin-D bindin...
Homo sapiens
EAW76962 5.3e-132 96.0 cyclin D bindin...
Homo sapiens
BAG54353 5.3e-132 96.0 unnamed protein...
Homo sapiens
AAH07418 5.5e-132 96.0 DMTF1 protein [...
Homo sapiens
BAG58937 6.8e-132 96.0 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp