Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07662
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209095
Product ID ORK07662
Clone name hj07206
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CDK11A
cDNA sequence DNA sequence (5066 bp)
Predicted protein sequence (360 aa)
Description solute carrier family 35, member E2
Features of the cloned cDNA sequence

Length: 5066 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1121 bp
Genome contig ID gi89161185r_1596135
PolyA signal sequence
(ATTAAA,-24)
+----*----+----*----+----*----+----
AAATTTGTAGAATTAAATCATTTTCCTTGTTGTGG
Flanking genome sequence
(27900 - 27851)
----+----*----+----*----+----*----+----*----+----*
AGGAAAGAGCTGTGTTTTCTCCGTGACTTGCCAGGGCATCTTCGGGTGCC

Features of the protein sequence

Length: 360 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92332 1e-90 100.0 cell division c...
Homo sapiens
AAC72086 5.6e-81 95.9 PITSLRE protein...
Homo sapiens
AAC95300 1.7e-80 95.6 PITSLRE protein...
Homo sapiens
CAI20033 1.4e-79 94.7 cell division c...
Homo sapiens
BAG64496 3.5e-79 97.5 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp