Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07697
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209437
Product ID ORK07697
Clone name pj01080
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol SEC11A
cDNA sequence DNA sequence (3626 bp)
Predicted protein sequence (258 aa)
Description Similar to FKSG60 (Fragment).
Features of the cloned cDNA sequence

Length: 3626 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2413 bp
Genome contig ID gi51511731r_82913781
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CTTCTAAAATTTTAAATAAAAGACTTTGCACATTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCCCTTATCCCTGAATTGTGTTTGTCGGGAAAGCTTCTGAAATTTGCC

Features of the protein sequence

Length: 258 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92674 7.9e-97 100.0 similar to FKSG...
Homo sapiens
XP_001170802 8.3e-46 80.4 hypothetical pr...
Pan troglodytes
EAW93653 4.6e-45 87.4 hCG2038420 [Hom...
Homo sapiens
XP_001139635 6.6e-45 81.3 hypothetical pr...
Pan troglodytes
EAW57759 8.2e-45 80.5 hCG2038827 [Hom...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp