Length: 3626 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR |
2413 bp |
Genome contig ID |
gi51511731r_82913781 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- CTTCTAAAATTTTAAATAAAAGACTTTGCACATTG |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* AACCCCTTATCCCTGAATTGTGTTTGTCGGGAAAGCTTCTGAAATTTGCC |
Length: 258 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)
|
Entry |
Exp |
ID% |
Protein |
Source |
BAD92674 |
7.9e-97 |
100.0 |
similar to FKSG...
|
Homo sapiens
|
XP_001170802 |
8.3e-46 |
80.4 |
hypothetical pr...
|
Pan troglodytes
|
EAW93653 |
4.6e-45 |
87.4 |
hCG2038420 [Hom...
|
Homo sapiens
|
XP_001139635 |
6.6e-45 |
81.3 |
hypothetical pr...
|
Pan troglodytes
|
EAW57759 |
8.2e-45 |
80.5 |
hCG2038827 [Hom...
|
Homo sapiens
|
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.