Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07736
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK07736
Clone name fh07519s2
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ZSWIM8
cDNA sequence DNA sequence (5919 bp)
Predicted protein sequence (1881 aa)
Flexi ORF Clone FXC07736
Description KIAA0913
Features of the cloned cDNA sequence

Length: 5919 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 273 bp
Genome contig ID gi89161187f_75115388
PolyA signal sequence
(TATAAA,-21)
+----*----+----*----+----*----+----
GGCATTTATAAATATATAAACTCCTTTTTTACTCT
Flanking genome sequence
(116170 - 116219)
----+----*----+----*----+----*----+----*----+----*
AGTCGACCTGGGCCTTTCCCTTCTTTCCAAATTCCATGTGCAGATGAACC

Features of the protein sequence

Length: 1881 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_536393 0 97.7 similar to CG32...
Canis lupus fam...
AAH85161 0 95.9 2310021P13Rik p...
Mus musculus
XP_507850 0 97.7 hypothetical pr...
Pan troglodytes
XP_001099765 0 97.3 similar to CG32...
Macaca mulatta
XP_862999 0 95.3 similar to CG32...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007527 257 293 PF04434 Zinc finger
ProfileScan IPR007527 257 293 PS50966 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp