ORK10382

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10382

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10382
Clone name	bm03679
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PRR7
cDNA sequence	DNA sequence (1463 bp) Predicted protein sequence (282 aa)
HaloTag ORF Clone	FHC10382
Flexi ORF Clone	FXC10382
Description	Proline-rich protein 7 (Synaptic proline-rich membrane protein)

Features of the cloned cDNA sequence

Description

Length: 1463 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	260 bp
Genome contig ID	gi51511721f_176706429
PolyA signal sequence (None)	+--------+--------+----*----+---- TGGCGGGAAGGACCCTCAACGTGCGTTTCCGCCAC
Flanking genome sequence (109561 - 109610)	----+--------+--------+--------+--------+----* AACAGAACCTAAGGGTACAGCACTAAGTCTAAGACCAACCCTTCTCCGGT

Features of the protein sequence

Description

Length: 282 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8TB68	1.3e-92	100.0	Proline-rich pr...	Homo sapiens
AAH21240	5.4e-92	99.6	PRR7 protein [H...	Homo sapiens
XP_001090579	4.9e-91	98.1	similar to prol...	Macaca mulatta
P0C6T3	4.1e-87	96.7	Proline-rich pr...	Rattus norvegicus
XP_853988	5.8e-87	96.0	similar to prol...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	20	TCFAGFWLIWGLIVLLCCFCSFL	42	PRIMARY	23